The authors have declared that no competing interests exist.
The emergence and spread of carbapenem-resistant gram-negative bacteria pose a serious threat to human health. Currently, little is known about the molecular mechanisms underlying carbapenem -resistance and their prevalence among APEC in Egypt. The aim of this study was to detect APEC in clinically diseased broiler chickens collected from broilers farms located at Dakahalia governorates, asses their virulence –associated genes, detect the antimicrobial susceptibility of recovered isolates and to detect genes encoding carbapenemase resistant.
A total of 100 organ tissue samples subjected to conventional culture technique for isolation of E. coli. The confirmed E. coli were subjected to disc diffusion method for detection their susceptibility to antimicrobials. Polymerase chain reaction (PCR) was used for detection of APEC virulence genes (hlyA, iutA, ompT, iss, iroN) and six carbapenem- resistant genes namely, blaIMP, blaVIM, blaKPC, blaOXA-48 blaGES and blaNDM,.
Forty isolates were confirmed to be E. coli among them, three or more APEC virulence- genes were detected from all isolates. The hlyA gene was detected in 90% (36/40), iroN in 95% (38/40), ompT in 97.5% (39/40), iutA in 92.5% (35/40) and iss was detected in 95% (38/40) of APEC isolates The tested isolates exhibited a remarkable resistance to ampicillin (97.5%), cefuroxime (92.5%), clindamycin (90%), chloramphenicol (62.5%), doxycycline (45%), amikacin (25%) and ciprofloxacin (12.5%). While, the retrieved isolates displayed 100 % sensitivity against imipenem, meropenem, ertapenem, ceftazidime and colistin. Concerning carbapenemase-encoding genes, blaIMP, blaVIM, blaKPC, blaOXA-48, blaGES couldn’t be detected among the E. coli isolates, while, blaNDM was confirmed in three isolates .
The detection of NDM as one of the carbapenem resistant genes reveals that the resistant strains are not only capable of infecting humans, but that carbapenams- resistant E. coli (CREC) has also started to pose a threat to poultry farm and other livestock animals. This may give rise to worries that these food-carrying creatures could infect humans or colonize them.
Although E. coli is thought to be a normal component of the microflora in the chicken intestine, some strains can spread to other internal organs and result in lethal disease known as colibacillosis
Multidrug resistance is a worrying problem that is being seen more frequently worldwide in both human and veterinary medicine
Carbapenems are considered the last-line antibiotics for treatment of microbial infection in human and it is commonly used to combat multiple resistant bacteria such as ESBL and MRSA which cannot be treated by other therapeutic options. However, there is concern that these carbapenemases will penetrate the food chain due to the recent discovery of this resistance in agricultural animals and poultry farms. Therefore, to maintain their effectiveness, the development and spread of resistance mechanisms against carbapenems have to be prevented. One benefit of this class of antibiotics is that carbapenems are comparatively resistant to hydrolysis by most -lactamases. They are however inactivated by carbapenemases, which also confer resistance to β-lactams
The appearance of carbapenemase-producing strains among gram-negative bacteria, particularly Enterobacteriaceae, has increased significantly over the past ten years, raising serious concerns and highlighting the need for prompt screening. Therefore, the aim of the present study was to detect presence of APEC in clinically diseased broiler chicken, detect the virulence- associated genes, investigate the antimicrobial susceptibility of recovered isolates and to identify the most common carbapenemase-encoding genes associated with the isolates under the study.
One- hundred unhealthy broiler chickens grown on commercial farms were included in this study. The selected birds were collected from commercial farm located in Dakahlia province, Egypt showed depression, high mortality rate, low body weight and loss of appetite. On postmortem examination, the birds showed pericarditis, fibrinopurulent, aerosaculitis and perihepatitis. The samples were transported under cold conditions to the laboratory in the Department of Bacteriology, Mycology and Immunology Department, Faculty of Veterinary Medicine, Mansoura University. All samples were processed within 3 hour after collection.
Chicken organ samples were directly enriched in MaCconkey broth and incubated at 37°C for 18 hours. Then, a loopful from the overnight enriched broth culture was streaked onto Eosin Methylene Blue and MacConkey agar (Oxoid). The streaked plates were incubated at 37°C for 24 hours under aerobic condition. Suspected colonies (pink colored colonies on MacConkey agar and green colonies with metallic shin on EMB) were picked and purified on tryptic soya agar plates (TSA) and stored for further identification. Preliminary identification of E. coli was performed based on Gram staining and the other standard biochemical examination
Tests were carried out by the disk diffusion method on Mueller–Hinton agar and the results were interpreted according to the clinical breakpoints recommended by the Clinical and Laboratory Standards Institute
Genomic DNA were extracted by boiling of 3-5 colonies of suspected isolates for 10 min in 100 μl of DNA/RNA free water followed by centrifuged at 13,000 rpm for 10 minutes. The supernatant from boiled lysate was used as DNA template. The concentration of the obtained DNA were tested using a Nanodrop (Nanodrop 1000, Thermo Scientific, UK)
The conventional PCR was used to confirm the suspected E. coli isolates using 16S rRNA. The confirmed E. coli isolates were then subjected for PCR for detection of 5 virulence-associated genes including, hlyA, iutA, ompT, iss, iroN. The primers sets used for amplification were obtained from invetrogen/USA
Genes | Primer Sequence (5′–3′) | Amplicons(bp) | References |
|
Forward: GCGTGGTTAAGGATGAACAC Reverse: CATCAAGTTCAACCCAACCG | 438 |
|
|
Foward:GGAATAGAGTGGCTTAAYTCTC Reverse: GGTTTAAYAAAACAACCACC | 232 |
|
|
Forward: AGTCGGCTAGACCGGAAAG Reverse: TTTGTCCGTGCTCAGGAT | 399 |
|
|
Forward: GATGGTGTTTGGTCGCATAReverse: CGAATGCGCAGCACCAG | 390 |
|
|
Forward: CGTCTAGTTCTGCTGTCTTGReverse: CTTGTCATCCTTGTTAGGCG | 798 |
|
|
Forward :GGTTTGGCGATCTGGTTTTCReverse :CGGAATGGCTCATCACGATC | 621 |
|
|
Foward :GACCTCGGTTTAGTTCACAGAReverse : CACACGCTGACGCTGACCA | 585 |
|
F:GGCTGGACATCATGGGAACTGG R: CGTCGGGAACGGGTAGAATCG | 302 |
|
|
|
F:CAGCAACCCGAACCACTTGATG R: AGCATTGCCAGAGCGGCAGAA | 323 |
|
F:TCATCCCGGAAGCCTCCCTCACTACTATR:TAGCGTTTGCTGCACTGGCTTCTGATAC | 496 |
|
|
F:GGCCACAGTCGTTTAGGGTGCTTACCR: GGCGGTTTAGGCATTCCGATACTCAG | 450 |
|
|
|
F:AATCCGGCAAAGAGACGAACCGCCTR:GTTCGGGCAACCCCTGCTTTGACTTT | 553 |
|
Polymerase chain reaction (PCR) was performed to investigate the presence of carbapenemase-encoding genes, including blaKPC, blaNDM, blaVIM, blaIMP, blaGES and blaOXA-48 using PCR. The oligonucleotide primers (Invitrogen) are illustrated in Table 1 as previously reported
Gene | Primary denaturation | Secondary denaturation | Annealing | Extension | No. of cycles | Final extension |
|
94˚C3 min. | 94˚C30 sec. | 60˚C1 min. | 68˚C2 min.. | 35 | 72˚C10 min. |
|
94˚C5 min. | 94˚C30 sec. | 55˚C30 sec. | 72˚C30 sec. | 35 | 72˚C7 min. |
|
95 ˚C15min | 95 ˚C1 min | 59 ˚C1min | 72 ˚C5 min | 30 | 72 ˚C |
|
95 ˚C15 min | 95 ˚C1min | 60.5 ˚C1min | 72 ˚C5 min | 30 | 72 ˚C |
|
95 ˚C15 min | 95 ˚C1 min | 63 ˚C1 min | 72 ˚C5 min | 30 | 72 ˚C |
|
95 ˚C15 min | 95 ˚C1 min | 55 ˚C1 min | 72 ˚C5 min | 30 | 72 ˚C |
|
95 ˚C15 min | 95 ˚C1 min | 55 ˚C1 min | 72 ˚C5 min | 30 | 72 ˚C |
Please add space between E and coli
GES is written not in italic but only bla in italic
Please correct in al manuscript.
No results about virulence genes were reported here?
Abbreviation for what?
Organ samples were collected from clinically diseased chicken and were initially subjected to traditional methods of E. coli isolation. Among them, 40 E. coli isolates were recovered based on microscopical and biochemical identification. The suspected isolates were then confirmed by PCR assay targeting 16S rRNA (
PCR was used to identify carbapenemase genes or metallo-β-lactamase genes. Out of six gene which was subjected to PCR, NDM-1 gene was identified in 3 strains, while, blaIMP, blaVIM, blaKPC, blaOXA-48 and blaGES couldn’t be detected.
Virulence -associated genes were screened by PCR assay using specific primers. The selected virulence- associated genes were detected in high prevalence rates. The hlyA gene was detected in 90% (36/40), iroN in 95% (38/40), ompT in 97.5% (39/40), iutA in 92.5% (35/40) and iss was detected in 95% (38/40) of APEC isolates (
Colibacillosis is a common infectious disease caused by APEC, since that it results in significant financial losses for the poultry sector, this disease is a critical issue
Presence of virulence factors in bacterial cell increase their capacity to cause disease. The present findings consequently extend and corroborate that numerous putative virulence genes engage in the pathogenesis of colibacillosis. Since these genes were also discovered in colibacillosis isolates from various countries. It has been proposed that APEC retain these genes contributing to the development of colibacillosis. In this study, the virulence- associated genes selected were detected in high prevalence (90%, 95%, 97.5%, 92.5% and 95%) for hlyA, iroN, ompT, iut and iss respectively. The presence of these genes are associated with avian colibacillosis and indicates presence of APEC
Infection with Carbapenem-Resistant Enterobacteriaceae (CRE) is emerging as an important challenge in health-care settings and a growing concern worldwide
All obtained E. coli isolates were subjected to antimicrobial susceptibility test. In this study the highest resistant was recorded against ampicillin (97.5%), cefuroxime (92.5%), clindamycin (90%) and chloramphenicol (62.5%). While, 100% sensitivity was recorded against imipenem, meropenem and colistin and 87.5%, to ciprofloxacin, 75% to amikacin and 55% to doxycycline. Dissimilar to this study, Kumarasamy et al.
Detection of carbapenem resistance genes, virulence-associated genes among APEC and profiling antimicrobial susceptibility in bacteria have been considered as an important work to recognize the pathogenesis and possible hazards of anti-microbial resistance of APEC. Colibacillosis can be prevented and controlled using antibiotics to treat the bacterial infections and to eliminate some predisposing causes. Therefore, restriction in antimicrobials use in poultry farms among veterinarians is highly recommended to control the spread of antimicrobial-resistant bacteria among poultry farm.